| Primary Identifier | MGI:6515815 | Allele Type | Endonuclease-mediated |
| Gene | Mcu | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A mutation that changes codon 96 from cysteine (TGC) to alanine (GCC) (p.C96A) was created with two gRNAS (targeting GAGAGCTGCGCTCGCGACGGTTA and AAGCCTATCTCTGACTCAGTCGG) and an ssODN template using CRISPR/Cas9 technology. The mutation mimics the human p.C97A gain-of-function mutation that results in a hyperactivated channel activity. |
