| Primary Identifier | MGI:6379288 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | U2af2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTAGGTCAACTAAGTTACG and ACTCTAGCTGGACTAAGTAC, which resulted in a 486 bp deletion beginning at Chromosome 7 position 5,070,084 bp and ending after 5,070,569 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000198884 (exon 7) and 347 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 201 and early truncation 5 amino acids later. |
