Primary Identifier | MGI:7660950 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Esf1 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCATTACAATTAGCTTTTAT and ACATAATTATTGGCAACAAA. This resulted in a 677 bp deletion of region Chr2:140,164,161-140,164,837 (GRCm38/mm10) and removes exon ENSMUSE00000557773. |