| Primary Identifier | MGI:5644715 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Serpina3n |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Serpina3n-6845J-M9384 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CTCAGAAGCGGTGTTAACTG, AGTGCCCATGATGAGCATGG and CCTGTTCTGTCCTCAGCCTA which resulted in a 402 bp deletion and an 8 bp insertion (ACAGTGTA) in intron 3 at Chromosome 12 positive strand position 104,411,059 bp (TAACTGAGGAGAAGGTGGAGTCTCTG in GRCm38) and ending after CTGTTCTGTCCTCAGCCTAAGGCC at position 104,411,460 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 212 and early truncation 1 amino acid later. |
