Primary Identifier | MGI:5907612 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cnot10 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CTAACATATAGCTCAGATTT, AATGCACTCTAACAACAGCA, TTGTTAGAGTGCATTCTGCC, which resulted in a 234 bp deletion spanning ENSMUSE00000448470 (exon 4) beginning at Chromosome 9 negative strand position 114,629,178 bp ATTCTGCCCGGATTGTTTCA, and ending after TAGATGACCTAAATCTGAGC at 114,628,945 bp (GRCm38/mm10). This mutation deletes exon 4 and 83 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 and early truncation 12 amino acids later. |