| Primary Identifier | MGI:7447464 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nes |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exons 1 and 4 were targeted with two sgRNAs (targeting GGAGCTCAATCGACGCCTGG and GCACAGGAGACCCTACTAAA) using CRISPR/Cas9 technology, resulting in an 8 bp deletion in exon 1 (CGCCTGGA chr3:87878561-87878568 (GRCm39)) that creates a reading frame shift and premature stop codon. |
