| Primary Identifier | MGI:7258422 | Allele Type | Endonuclease-mediated |
| Gene | Alx1 | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology using sgRNAs targeting intron 1 (GTAAGATGTGGGTGGTACT) and intron 2 (TTACTAAGTATAGGGACAGG) deleted exon 2. Sequencing of RT-PCR products confirmed the production of mutant mRNAs from splicing exon 1 to exon 3, which leads to a frame-shift and is predicted to produce a truncated protein containing only the N-terminal region and lacking the homeodomain and the C-terminal Aristaless domain. Western blot analysis confirmed that embryos lack full-length protein and only produce truncated product that is expressed at low levels. |
