| Primary Identifier | MGI:7424890 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(3)2Jfm |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The putative Pitx2 AF (atrial fibrillation)-related enhancer, located upstream of the gene, was targeted with sgRNAs (targeting GCTGGGAGATACAAAGCCAGG, GCTATTGTTAATGAAGACCA, GAGACACTAATCCAGCCCTG and GCCAAACTATACCCTTCAATG) using CRISPR/Cas9 technology, resulting in an ~62 kb deletion. The deleted sequence contains predicted enhancer Rr791245. |
