| Primary Identifier | MGI:6294099 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab31 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGCTTTCTAGGGACAAAA and GGAGTTTCGATGATGCAGAA, which resulted in a 142 bp deletion beginning at Chromosome 17 position 65,717,444 bp and ending after 65,717,585 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000657070 (exon 3) and 60 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 29 amino acids later. There is a 5 bp insertion (TAAAG) at the deletion site. |
