| Primary Identifier | MGI:6357866 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | AI467606 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted with sgRNAs (targeting GCTCCCTGAGCCTACAGCGGAGG and AGCGTGCCCCCACCCTAGTCTGG) using CRISPR/Cas9 technology, resulting in a 197 bp deletion in the 5' end of the CDS in exon 2. |
