| Primary Identifier | MGI:6156444 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpcpd1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1034 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATAATAAATCGGAGCGAGCA targeting the 5' side and GATATGTAGCCCAAACTTGG targeting the 3' side of a critical exon. This resulted in a 595-bp deletion Chr2:132546771 to 132547365_insGGGATTCC.(GRCm38). |
