| Primary Identifier | MGI:7614313 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Cdca7 |
| Strain of Origin | FVB/NJ-Tg(HBA1-GFP)1Ew/Ew | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glycine codon 305 (GGC) in exon 7 was changed to valine (GTC) (c.914G>T;p.G305V) using an sgRNA(targeting AGGGACCACAGAATTGGCCCCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the carboxyterminal 4-CXXCâtype zinc finger (ZF) domain of the encoded peptide, is the equivalent of the human c.881G>T; p.Gly294Val mutation associated with immunodeficiency, centromeric instability, facial anomalies syndrome 3 (ICF3). |
