Primary Identifier | MGI:7311993 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Sec61g |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TGACATGGTTCCTATAACAA and GTACATCTAATTCCTCATTG, which resulted in a 4057 bp deletion beginning at Chromosome 11 position 16,454,576 bp and ending after 16,458,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287615, ENSMUSE00001286315, ENSMUSE00000681061 (exons 1,2 and 3) and 3473 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele. |