|  Help  |  About  |  Contact Us

Allele : Sec61g<em1(IMPC)J> SEC61 translocon subunit gamma; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7311993 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sec61g
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TGACATGGTTCCTATAACAA and GTACATCTAATTCCTCATTG, which resulted in a 4057 bp deletion beginning at Chromosome 11 position 16,454,576 bp and ending after 16,458,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287615, ENSMUSE00001286315, ENSMUSE00000681061 (exons 1,2 and 3) and 3473 bp of intronic sequence including the start site, splice acceptors and donors and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories