| Primary Identifier | MGI:6149762 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tg |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCAATGCGAGTTGCAGGG, ACAACGCTGGCAAAAAAGGG, TATGACCTGTAGTTGTTGAA and ATAATGAGCCCTTTTCCATT, which resulted in a 372 bp deletion beginning at Chromosome 15 position 66,672,114 bp and ending after 66,672,485 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000439658 (exon 3) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early truncation 17 amino acids later. |
