|  Help  |  About  |  Contact Us

Allele : Rr44606<em1Ddu> regulatory region 44606; endonuclease-mediated mutation 1, Denis Duboule

Primary Identifier  MGI:7327111 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr44606
Strain of Origin  C57BL/6 x CBA Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting TGATCTCTAGGCGGCGCTCG) with CRISPR/Cas9 technology, a 42 bp deletion (CTCACCCGCGAGCGCCGCCTAGAGATCAGTAAGAGCGTTAAC) was created in this Hoxd CTCF binding site region in Hoxd10 exon 2.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • deltaCB3,
  • deltaCB3
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele