Primary Identifier | MGI:6260045 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Sytl5 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAGGGGAAAACTAATCGAG and CCTTACGTCATTTCACAACT, which resulted in a 544 bp deletion beginning at Chromosome X position 9,913,615 bp and ending after 9,914,158 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000656653 (exon 3) and 428 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 110 and early truncation 1 amino acid later. |