| Primary Identifier | MGI:5812880 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slmap |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Slmap-8150J-M2409 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAAGATGAACTTACAGCG, CTATAGTGTCAGGAAGCGCT, TGAGTGGTTTCAGTTGATAG and CGTCTCAAAACTTTTAAAGA, which resulted in a 544 bp deletion beginning at Chromosome 14 negative strand position 26,483,082 bp, GTTTCAGTTGATAGGGGAAA, and ending after TAAGATGAACTTACAGCGTG at 26,482,539 bp (GRCm38/mm10). This mutation deletes exon 3 and 396 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 9 amino acids later. |
