| Primary Identifier | MGI:6314215 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc15 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGACTGAAGTAACCAGTTA and AAAGTTTCGTTGTAAATATA, which resulted in a 13,775 bp deletion beginning at Chromosome 9 position 37,302,836 bp and ending after 37,316,610 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000344794-ENSMUSE00000335669 (exons 6-12) and 12,426 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 233 and early truncation 1 amino acid later. |
