| Primary Identifier | MGI:7797733 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready | Gene | Pole |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using CRISPR technology, a sgRNA (AGTGGAGGCTCAAGTGGCAT) was designed to target the Pole gene to introduce Lox-Stop-Lox cassette and a GTT to CTT mutation in exon 13 resulting in a valine to leucine change at amino acid 411 (V411L). |
