Primary Identifier | MGI:7574243 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Csdc2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTTCCTGCTGACTATCCCTG and GTGAGGATACCGAGGCAGGG. This resulted in a 2,287 bp deletion of Chr15:81,946,521-81,948,807 (GRCm38/mm10) that removes exons ENSMUSE00000252667 and ENSMUSE00000556790. |