|  Help  |  About  |  Contact Us

Allele : Tctn3<em1(IMPC)J> tectonic family member 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5812886 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tctn3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tctn3-8161J-M2441 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAGCAGTAGTTTAAAGG, CTTATTAACTAAAAGTAAGA, GCATTCCCAGGAAAGCCCAA and CCTACCCGCTGTCTCCCGGT, which resulted in a 448 bp deletion beginning at Chromosome 19 negative strand position 40,611,575 bp TGGGCTTTCCTGGGAATGCT, and ending after AACATTAGTAATTTCATGAG at 40,611,128 bp (GRCm38/mm10). This mutation deletes exon 3 and 329 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion 10 bases before the 448 bp deletion and a 13 bp deletion 3 bases after the 448 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 114 and early truncation 43 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tctn3<em1J>,
  • Tctn3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories