Primary Identifier | MGI:6341938 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Coa6 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences GAAGCTGAGGAGCTCGTTCGAGG, CGACCTGTACTGGCGCTGCCTGG, which resulted in a Intra-exdel deletion. |