Primary Identifier | MGI:6356810 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Mrap |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from project TCPR1375 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAGTTGCAACGTCACCGCTA and TGGCACCTGGTTCCGTGGAG targeting the 5' side and ACGCTAGCATGAACGAGTGC and ACCGGTAGTCACCTCGGGCT targeting the 3' side of a critical region. This resulted in a 921-bp del Chr16: 90747067 to 90747987 (GRCm38). |