| Primary Identifier | MGI:7327566 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Gaa |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Guide RNAs (CGCAGATGTCCGCCCCGACC and GCAGATGTCCGCCCCGACCA) were designed to create a GAC to GAA mutation at position 1935, resulting in an aspartic acid to glutamic acid change at amino acid 645 (Asp645Glu). This mutation has been identified as the most frequent GAA pathogenic mutation in people of Taiwanese and Southern Han Chinese ethnicity, causing infantile-onset Pompe disease (IOPD). A silent protospacer adjacent motif (PAM) site mutation (Gaa(c.1920C to T)) and a gRNA seed region mutation (Gaa(c.1923G to C)) were introduced, as well as two silent mutations (Gaa(c.1929G to A) and Gaa(c.1932G to A)) to prevent gRNA editing of the donor template. |
