Primary Identifier | MGI:7481968 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Phldb3 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATCTGATGACATCACTTGG and GCTCAGTTCTGGCTTCGGAT, which resulted in a 3288 bp deletion beginning at Chromosome 7 position 24,623,679 bp and ending after 24,626,966 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000890035, ENSMUSE00000890716, ENSMUSE00000499900, ENSMUSE00000891408, ENSMUSE00000479582 (exons 10-14) and 2714 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 384 and early truncation 34 amino acids later. |