|  Help  |  About  |  Contact Us

Allele : Rprd1a<em1(IMPC)J> regulation of nuclear pre-mRNA domain containing 1A; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5792573 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rprd1a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Rprd1a-7936J-F7112 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTTATGTGGCTGATGAG, AGCGTTCATACAGTGTGTGA, CGCTGCTACTAACATCTCCA and GATGAGTGTGTTCGGAGAAG, which resulted in a 333 bp deletion beginning at Chromosome 18 negative strand position 24,510,041 bp, TAGCAGCGACGTGATGAGTG, and ending after TAAAGCGTTCATACAGTGTG at 24,509,709 bp (GRCm38/mm10). This mutation deletes exon 2 and 203 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (A) at the site of the deletion and another insertion (T) 37 bp before the 333 bp deletion that will not alter the result of the mutation. This 333 bp deletion is predicted to cause a change of amino acid sequence after residue 50 and early truncation 28 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rprd1a<em1J>,
  • Rprd1a<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories