| Primary Identifier | MGI:6316196 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mkrn3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0782 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GCGGCCGCGTGGGCCTCAAT and ATCGGGTCTGGCACCGCTCC targeting the 5' side and TTTCCCTCTCGCAACTGCAC and GAGCCAACGGTCATCAGAGA targeting the 3' side of exon ENSMUSE00000593055 resulting in a 1,434-bp deletion of Chr7 from 62418584 to 62420017 and a 8-bp deletion of Chr7 from 62418464 to 62418471 (GRCm38). |
