| Primary Identifier | MGI:6156601 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Otc |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR922 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAGAGACATGCTGCACTATG and AATGCTGTGGGGTAGTCCAT targeting the 5' side and AAGCAATTACCTTGCCTGTG targeting the 3' side of a critical region. This resulted in a 258-bp del ChrX:10264681 to 10264938 and 5-bp indel ChrX:10264981 to 10264985_delCCTTT_ins AA resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). |
