| Primary Identifier | MGI:7660785 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Aifm3 |
| Strain of Origin | Not Specified | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology targeting the intron 3-exon 4 junction using gRNAs UUCAAUCUUGAGCUCCACUG and GUGCUGCCAGAGAAAGAGCG generated a 9 bp deletion (chr16:17317404 GTCCACAGTG > G), resulting in a splice acceptor deletion and subsequently frameshift mutation. |
