| Primary Identifier | MGI:5605979 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dolk |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project Dolk-5942-1899 was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CGTAGAAGGCCTGCACCGCG and ACGTCCAGTACAAGTGGGAC, which resulted in a 25 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 30285881 (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 50 and early truncation 32 amino acids later. |
