| Primary Identifier | MGI:6302770 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tomm70a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTGCCTAGTGTTCGGGA and AGAGAACAAAGTCTCAACCG, which resulted in a 496 bp deletion beginning at Chromosome 16 position 57,134,423 bp and ending after 57,134,918 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130105 (exon 3) and 369 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 169 and early truncation 7 amino acids later. |
