|  Help  |  About  |  Contact Us

Allele : Dgke<em1(IMPC)Tcp> diacylglycerol kinase, epsilon; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156468 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dgke
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA and 2 guide sequences TGTAATGTGGTAACACCTGTAGG, CCTCTGTACTGGAGCTGGAAATC, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories