Primary Identifier | MGI:6293840 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Spred2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at UC Davies by injecting and 2 guide sequences CCGCTTCCCTTTCCAGTACAGTC, CCGACTCCAGTGTCAGATTGTAG, which resulted in a Exon Deletion. |