| Primary Identifier | MGI:6879492 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tent5d |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAATGCAAACATGTTCCC and TGGTATGATTGCTAAAAGTT, which resulted in a 3070 bp deletion beginning at Chromosome X position 107,870,055 bp and ending after 107,873,124 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000653984 (exon 6) and 455 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele. |
