Primary Identifier | MGI:6156566 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Lamp3 |
Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from project TCPR1017 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTATAACTAGCTGAGCTGAT targeting the 5' side and TCATAAGTTCCGATCTTGGC targeting the 3' side. This resulted in a 1-bp insertion at Chr16:19701123_insT; (predicted effect on protein p.S104Kfs*4) (GRCm38). |