|  Help  |  About  |  Contact Us

Allele : Lamp3<em1(IMPC)Tcp> lysosomal-associated membrane protein 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156566 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lamp3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1017 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTATAACTAGCTGAGCTGAT targeting the 5' side and TCATAAGTTCCGATCTTGGC targeting the 3' side. This resulted in a 1-bp insertion at Chr16:19701123_insT; (predicted effect on protein p.S104Kfs*4) (GRCm38).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele