| Primary Identifier | MGI:5755482 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rbpms2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rbpms2-7534J-F9923 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTAGAGAGGGCCCCAGA, GCTGTAAGACTTTTCCACAA, ACATATTCAGATCCTGAGAT, and TCTAGGCTGAGCCAGAGGGC, which resulted in a 270 bp deletion spanning exon 6 beginning at Chromosome 9 positive strand position 65,650,854 bp, CAACCTTCTGGGGCCCTCTCT and ending after CCTTCTCCTGCCCTCTGGCT at 65,651,123 bp (GRCm38/mm10). This mutation deletes exon 6 and 119 bp of flanking intronic sequence including the splice acceptor and donor. In addition to the large defined deletion there are two small deletions of 6 bp (CTTTCC) and 19 bp upstream of the 270bp deletion that will not affect the results of the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 69 and early truncation 2 amino acids later. |
