Primary Identifier | MGI:6153760 | Allele Type | Endonuclease-mediated |
Attribute String | Not Specified | Gene | Tgm3 |
Strain of Origin | C57BL/6N | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence GATTCTGGCATCATCTATGTGGG, and a donor oligo, which resulted in a Point Mutation allele. |