| Primary Identifier | MGI:7484719 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Adar |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Proline codon 195 was changed to alanine (c.583C>G p.P195A) using an sgRNA (targeting GCAAGGCAAGCTTCGCACCA) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.P193A mutation associated with Aicardi-Goutieres syndrome (AGS). |
