|  Help  |  About  |  Contact Us

Allele : Cfap53<em1Hmd> cilia and flagella associated protein 53; endonuclease-mediated mutation 1, Hiroshi Hamada

Primary Identifier  MGI:6720857 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cfap53
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with two sgRNAs (targeting CCTCTTAATTTTTACTTATTGTA and GGTGAGCCAAAATATGGGCC) using CRISPR/Cas9 technology, resulting in the deletion of the exon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cfap53<->,
  • Cfap53<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele