| Primary Identifier | MGI:6316202 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nelfa |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0949 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of ATACCATCCTACACCAGACT and AGGAATGGATCAATCCACGC targeting the 5' side and TGATTCAACTTTAAAGACGG and GGAGAACAAGTCAGTGACGA targeting the 3' side of exon ENSMUSE00000602528 and ENSMUSE00000602527 resulting in a 838-bp deletion Chr1:52640706 to 52641543 (GRCm38). |
