| Primary Identifier | MGI:5795947 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Acadsb |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATACATAGAGGAAAGCAATT, TGCAGAAGACGCATACATAG, CCACGACCAGAGGGGCAAGA and AGATGTGCTCATCTCTGCGG, which resulted in a 233 bp deletion beginning at Chromosome 7 positive strand position 131,424,431bp CTCTATGTATGCGTCTTCTG, and ending after TCAACTTCACCCTCTTGCCC at 131,424,663 bp (GRCm38/mm10). This mutation deletes exon 2 and 73 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (CTGC) 49 bp after the 233 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 14 and early truncation 25 amino acids later. |
