|  Help  |  About  |  Contact Us

Allele : Rr207<em1LinJ> regulatory region 207; endonuclease-mediated mutation 1, Lin Jiang

Primary Identifier  MGI:7316892 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr207
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  An A-to-G mutation was engineered in this Tbx3 enhancer using sgRNAs (targeting GGCAAGCCAGAGAAACGGGAAGG and GGGAGGTCAGTCATAATTGGCGG) and an ssODN template (GCGTCTGGGAGGTCAGTCGTAATTGGCGGAAGTTT) with CRISPR/Cas9 technology.
  • mutations:
  • Single point mutation
  • synonyms:
  • TBX3 enhancer KO,
  • TBX3 enhancer KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories