| Primary Identifier | MGI:6220669 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Cd4 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and ACTGACACACCCGCTCATCA), resulting in a deletion of the "maturity" enhancer E4m, a cis regulatory element in intron 1 of the Cd4 gene (chr6:124861963-124862659 (GRCm39)). |
