Primary Identifier | MGI:6121485 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Nol9 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATAGGTAAATCACTAGTTA, GATTGAGGGCCTTAAGACTC, GCTAAGCTCTAGGTTGTCAC and TTATGAGAGTTGAAGCTGGT, which resulted in a 675 bp deletion beginning at Chromosome 4 position 152,040,765 bp and ending after 152,041,439 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001282963 (exon 2) and 455 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 151 and early truncation 16 amino acids later. |