Primary Identifier | MGI:6324040 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Eif5b |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCATCCCTTAAAGGTCATG and AGAAGGCTCTGGTTCATGTT, which resulted in a 800 bp deletion beginning at Chromosome 1 position 38,018,772 bp and ending after 38,019,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340970 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 75 amino acids later. |