Primary Identifier | MGI:6856856 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Arrdc4 |
Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
Is Wild Type | false | Project Collection | IMPC |
molecularNote | CRISPR-targeting with single guide RNAs having spacer sequences of GTATGGTCTTTTTCAGGTGA targeting the 5' side and GACGCTCTGATCTGGAACTT targeting the 3' side of a critical region. This resulted in a 358-bp del Chr7: 68744854-68745211 (p.E101Sfs56*). (GRCm38). |