| Primary Identifier | MGI:6342514 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc4a1ap |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTCCAGGAGGTGATCCC and CCAGTGCTATTAAGCTACCA, which resulted in a 391 bp deletion beginning at Chromosome 5 position 31,531,863 bp and ending after 31,532,253 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226900 (exon 4) and 330 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 328 and early truncation 2 amino acids later. There is a single bp insertion (A) at the deletion site. |
