Primary Identifier | MGI:6284505 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Cntnap5b |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGTGGTATGCCCTGTAGA and TAGCCCAGCTAAGATAAAG, which resulted in a 385 bp deletion beginning at Chromosome 1 position 100,075,903 bp and ending after 100,076,287 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000965671 (exon 6) and 200 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 244 and early truncation 10 amino acids later. |