Primary Identifier | MGI:6379292 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Pjvk |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACGTGTGTGAATCTGAGGT and ATGTGGTTACTCTAACACTG, which resulted in a 500 bp deletion beginning at Chromosome 2 position 76,652,084 bp and ending after 76,652,583 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000644344 (exon 3) and 358 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 23 amino acids later. |